Buscador de Tesis y publicaciones académicas

Morphological, molecular, and isotopic approaches to termite ecology: a mangrove case study

Casalla Daza, Robin

#NEXUS[ ALL SAMPLES VIPIS] begin data; dimensions ntax=7 nchar=1532; format datatype=dna interleave=no gap=-; matrix Coptotermes_testaceus GGAGCATCTCCCATCATAGAACAACTAGTCTTCTTCCACGACCACGTACTAATAATTATACTAATAATTACTACAACCGTATCATACATAATAATCACTCTGATCCGAAACAAACAAACCAGACGATTCATACTAGAAGGACAAATAATTGAAACCACATGAACCATTGCACCTGCAATCA...

Correction: Microbial diversity in the critically endangered Orinoco crocodile (Crocodylus intermedius): influence of body site and Helicobacter spp. on microbiota composition

Castelli, Loreley · García-Amado, María Alexandra · Rudolf, Carla A. · Contreras, Monica · y 2 más

Draft genome sequence of Serratia surfactantfaciens strain 5b, a cadmium-precipitating bacterium isolated from cocoa farm soil

Kevin Nonsocua-Triviño · Pedro F. B. Brandão

ABSTRACT We present the draft genome of Serratia surfactantfaciens strain 5b, a cadmium-precipitating bacterium isolated from a cocoa farm soil in Santander, Colombia. It comprises 4.99 Mbp across 28 contigs, 59% GC content, and 99.82% completeness. This genomic resource supports studies on ureolytic microbiologically...

Dataset supporting the analysis and SCAPS simulation of 191 perovskite solar cell devices derived from the Jacobsson database

Rojas Rincon, Clara Lizeth · Botero Londoño, Mónica Andrea · Sepúlveda, F. Alexander

This dataset supports the research article analyzing perovskite solar cell devices using experimental data extracted from the Jacobsson database and numerical simulations performed with SCAPS. The dataset contains four main components: 1. Experimental data extracted from the Jacobsson perovskite solar cell database (19...

Measuring digital maturity in MSMEs: An integrated statistical model of digitization, innovation, and sustainability

Sérgio Castro Gomes · Adão Maximiliano De Souza Regis · Domingo García-Pérez-de-Lema · Dinaldo Araujo · y 1 más

The literature on digital transformation in micro, small, and medium-sized enterprises (MSMEs) has advanced in a fragmented manner, often focusing separately on digitalization, innovation, or sustainability. This fragmentation has limited understanding of digital maturity within firms and reduced the effectiveness of p...

Mitochondrial-Localized Keratin 17 Promotes Chemoresistance in Basal-like Pancreatic Cancer

Chun-Hao Pan · Yinghuan Lyu · Monisankar Ghosh · Md Afjalus Siraj · y 21 más

Abstract The basal-like molecular subtype of pancreatic ductal adenocarcinoma (PDAC) is highly lethal and therapy resistant. A better understanding of the underlying molecular mechanisms driving this aggressive tumor subtype is necessary for the development of effective therapies. Notably, upregulation of keratin 17 (K...

Diagnostic Accuracy of Molecular Testing on Saliva and Oral Swabs for Pulmonary Tuberculosis

Deninson Alejandro Vargas · Jose Fernando Fuertes-Bucheli · Andrea Sanchez-Hidalgo · Jairo Palomares Velosa · y 8 más

Abstract Background Rapid, accurate, nonsputum tests are needed to close gaps in tuberculosis (TB) detection. We evaluated the diagnostic performance of molecular testing on saliva and oral swabs. Methods We conducted a nested case–control study with 1:1 incidence-density sampling within a prospective cohort of adults...

Modelo de creación de una línea de producción para la fabricación de una chupeta con chicle para la empresa Alfondoque S.A.S.

García Pecha, Jimer Johan · Díaz Vargas, Luna Alejandra · Velandia Arevalo, Juan Pablo

El presente proyecto propone el diseño de una nueva línea de producción en la empresa Alfondoque Dulces Típicos S.A.S., orientada a la fabricación de chupetas con relleno de chicle, en respuesta a una demanda específica de clientes mayoristas y a las tendencias actuales del mercado confitero. La iniciativa busca divers...

Figure 2 from: Tavera J, Beltrán-León BS, Polanco F A, Zapata LA, Zapata FA, Acero P A (2026) Voucher-verified checklist of Colombian Pacific marine fishes with emphasis on material deposited in Colombian museums. ZooKeys 1272: 337-387. https://doi.org/10.3897/zookeys.1272.141461

Tavera, Jose · Beltrán-León, Beatriz S. · Polanco F, Andrea · Zapata, Luis A. · y 2 más

Figure 2 Coarse ecological tree map of Colombian Pacific marine fish fauna. Shallow species correspond to 51%, inhabitants of the continental shelf 28%, and deep waters dwellers 21%.

Figure 1 from: Tavera J, Beltrán-León BS, Polanco F A, Zapata LA, Zapata FA, Acero P A (2026) Voucher-verified checklist of Colombian Pacific marine fishes with emphasis on material deposited in Colombian museums. ZooKeys 1272: 337-387. https://doi.org/10.3897/zookeys.1272.141461

Tavera, Jose · Beltrán-León, Beatriz S. · Polanco F, Andrea · Zapata, Luis A. · y 2 más

Figure 1 Geographic map of Colombia. The area of the Colombian Pacific Ocean is highlighted in gray.